Analysis is done using the SIGSCAN Version 4.05 suite of programs developed by Dr. Dan Prestridge. Information on SIGSCAN is maintained at the Advanced Biosciences Computing Center, University of Minnesota.
If you use this program in published research, please cite:
SIGNAL SCAN is offered to you as is, and so are its results, with no promises. A signal, defined here, is any short DNA sequence that may have known significance. What SIGNAL SCAN does is find homologies of published signal sequences in your sequence, most of these transcriptional elements. It cannot, at this time, predict if what it does find, has any meaning. The interpretation of those results are up to you. Most signal elements found probably will not have any meaning, as the elements are in the wrong milieu, wrong cell type, or wrong organism. Consequently, there will be many more erroneous signals found by SIGNAL SCAN than significant ones.
The significance probably varies greatly with the signal length. There are many matches for CP1 in any sequence because it is a very short sequence with a high probability of random occurrence. There are fewer, and likely more significant, glucocorticoid elements because of its larger signal sequence.
There is also a great possibility that elements that are in your sequence will be missed by SIGNAL SCAN, even if those elements are represented in the data files. This can happen if your element does not fall within the consensus of the reported signal in the literature. Use the Journal Citation feature to find references to the signals.
Probably the major benefit and use of SIGNAL SCAN is to find out the identity of unknown proteins bound to characterized binding sites in DNA sequences.
Interpreting the Results:
The results show
the name of the signal, the published signal sequence, and the location (loc)
of the first base pair of your sequence that includes that signal. A (-)
symbol indicates that the signal sequence was found on the opposite strand of
your input sequence, and that the signal sequence is in the reverse
orientation, such that the 1st base pair listed is actually the last base
pair in the signal, but still the first base pair in your sequence.
An illustration to wit:
Signal: AATGC signal found on forward strand, (+)
AATGC
Your seq: 5' GGTTTCTGAAAGCATTGCCTAAATGAGATGAATGCAAAATTTGGCGCGCGTTGTCCC 3'
opp.strand:3' CCAAAGACTTTCGTAACGGATTTACTCTACTTACGTTTTAAACCGCGCGCAACAGGG 5'
CGTAA
same signal found on opposite strand, (-)
The 1st bp on the original seq. strand of the signal is the first A of AATCG.
The 1st bp of the signal on the opposite strand is the C of CGTAA,
the opposite strand equivalent of AATGC. 'C' is the 3' end of the signal.The binding factor name is given if possible. If the binding factor is unknown then the TFD site name is used. Each signal found in your sequence has its TFD S##### shown (or TRANSFAC site numbers (R#####). These can be used to find the factor name, specific site name, and journal citation.
Dr. Prestridge encourages feedback - of both positive and negative results; send E-mail to danp@biosci.umn.edu. Any feedback will help to improve the programs in the future.