WWW SIGNAL SCAN Output Options

  1. By Group:
  2. By Order:
  3. Mapped to Sequence:
By Group:

"By Group" returns the sesults of the search grouped by signal. Signals are grouped together.

Example of "By Group" results:

Factor or Site Name           Loc.(Str.)   Signal Sequence        SITE #
------------------------------------------------------------------------
CTCF                  fact    362 (-) CCCTC                       S01948
ER                    fact    110 (-) GGTCA                       S01415
bA-globin.3           site    255 (-) CCAAT                       S00705
ovotransferrin_       site    269 (-) GGAAGGGAAG                  S01072
U2snRNA.2             site     47 (-) GTGCC                       S01031
U2snRNA.2             site    180 (-) GTGCC                       S01031
ADR-1                 fact    122 (+) GGAGA                       S02098
GAL4                  fact    276 (+) TCCTC                       S00686
GAL4                  fact    427 (+) TCCTC                       S00686
GAL4                  fact    436 (+) TCCTC                       S00686
AL4                   fact     70 (-) TCCTC                       S00686
GAL4                  fact     16 (-) TTATC                       S00687
GCN4                  fact    407 (+) AAGTCA                      S00808
GCN4                  fact     81 (+) TGATTC                      S00809
SBF                   fact     49 (+) CACGAAAA                    S02037
HIS4_US               site    408 (-) TGACT                       S01125
HO_site               site     49 (+) CACGAAAA                    S01105
URS2                  site     49 (+) CACGAAAA                    S00103

By Order:

"By Order" returns the results in the order the signals occur in the input sequence.

Example of "By Order" results:

     Factor or Site Name     Loc.(Str.)      Signal Sequence      SITE #
-----------------------------------------------------------------------
GAL4                  fact     16 (-) TTATC                       S00687
U2snRNA.2             site     47 (-) GTGCC                       S01031
SBF                   fact     49 (+) CACGAAAA                    S02037
HO_site               site     49 (+) CACGAAAA                    S01105
URS2                  site     49 (+) CACGAAAA                    S00103
GAL4                  fact     70 (-) TCCTC                       S00686
GCN4                  fact     81 (+) TGATTC                      S00809
ER                    fact    110 (-) GGTCA                       S01415
ADR-1                 fact    122 (+) GGAGA                       S02098
U2snRNA.2             site    180 (-) GTGCC                       S01031
bA-globin.3           site    255 (-) CCAAT                       S00705
ovotransferrin_       site    269 (-) GGAAGGGAAG                  S01072
GAL4                  fact    276 (+) TCCTC                       S00686
CTCF                  fact    362 (-) CCCTC                       S01948
GCN4                  fact    407 (+) AAGTCA                      S00808
HIS4_US               site    408 (-) TGACT                       S01125
GAL4                  fact    427 (+) TCCTC                       S00686
GAL4                  fact    436 (+) TCCTC                       S00686

Mapped to Sequence:

Mapped returns the results mapped below your input sequence. The signals reported begin in your sequences directly above the (+) or (-) symbols (for plus or minus strand). The first bp of a signal begins directly above the + in (+) strand signals.

Example of "Mapped" results:

(+) = Current Strand<br>
(-) = Opposite Strand

1      AGATCTTCCAGGCTGGATAAATAAACAAATCAGATAGCAAACTAATGGCA
                    (-)GAL4 S00687
                                                    (-)U2snRNA.2 S01031
                                                      (+)SBF S02037
                                                      (+)HO_site S01105
                                                      (+)URS2 S00103

51     CGAAAAACATATTTTCACGGAGGAAAAAAATGATTCTGGTTATACGAGTG
                         (-)GAL4 S00686
                                    (+)GCN4 S00809

101    TATGGAATTTGACCTCGCCTCGGAGAAACACTACACAAAAGCTGTCTTTA
               (-)ER S01415
                           (+)ADR-1 S02098

151    ATAGACGCCTGTGGTTTAAGAGCGGCAGGGGCACTGTCCTTCATGCGTTC
                                   (-)U2snRNA.2 S01031

201    ACAAAAACAGAGCCGTAATTGTGGCTGCTGCTGTGGGCAGGATTTATTTC

251    TTCAATTGGCTAAATCGTCTTCCCTTCCTCGAAGGTGATATCTGTGTTTT
          (-)bA-globin.3 S00705
                        (-)ovotransferrin_ S01072
                               (+)GAL4 S00686

301    CAAAATTCACAGCTGCCGGCCGGGGGCTGGCAAACCGACCCCAACCTCTA

351    CACAAAAATAAGAGGGGATACAAAGCCGGGGAAATAAAGTTGTTGTAAAT
		(-)CTCF S01948

401    AATTCTAAGTCACCACCTCCCCCGAATCCTCTGTATCCTCGCCGGGCGTG
            (+)GCN4 S00808
             (-)HIS4_US S01125
                                (+)GAL4 S00686
                                         (+)GAL4 S00686
Return to Signal Scan Analysis